Review



foxp3 transcription factor staining buffer set kit ebioscience  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Miltenyi Biotec foxp3 transcription factor staining buffer set kit ebioscience
    Foxp3 Transcription Factor Staining Buffer Set Kit Ebioscience, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 53 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/Transcription+Factor+Staining+Buffer+Set/pm33508229-573-54-66
    Average 97 stars, based on 53 article reviews
    foxp3 transcription factor staining buffer set kit ebioscience - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Staining:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Purification:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Blocking Assay:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Cell Stimulation:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    CRISPR:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Negative Control:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Recombinant:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Control:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Membrane:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Cell Isolation:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Single Cell:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    RNAscope:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Multiplex Assay:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Amplification:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    Fluorescence:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: H37 Ra BD Biosciences Cat#231141 Ovalbumin 323-339 peptide Sigma Cat#O1641-1MG Ovalbumin-A488 Invitrogen Cat#O34781 Ovabumin-A594 Invitrogen Cat#O34783 Ovalbumin-A647 Invitrogen Cat#O34784 5-FAM-Amyloid b-Protein (1-40) Bachem Cat#4090152.0100 5-FAM-Amyloid b-Protein (1-42) Bachem Cat#4090151.0100 Myelin Basic Protein Antigen Sigma-Aldrich Cat#MO689 Cy5 Conjugation Kit (FAST) Abcam Cat#ab188288 QTRACKER Qdot655 Vascular Labels Thermo Fisher Cat#Q21021MP FluoSpheres (0.1 mm) Thermo Fisher Cat#F8803 Dextran, Texas Red, 3000 MW, Lysine Fixable Invitrogen Cat#D3328 RNAscope Target Probe H2-Ab1 Advanced Cell Diagnostics Cat#414731-C1 RNAscope Target Probe Flt4 Advanced Cell Diagnostics Cat #481371-C1 RNAscope Target Probe Pecam1 Advanced Cell Diagnostics Cat #316721-C2 RNAscope Target Probe Aif1 Advanced Cell Diagnostics Cat #319141-C2 RNAscope Target Probe Cd3e Advanced Cell Diagnostics Cat #314721-C3 RNAscope Target Probe Pdgfrb Advanced Cell Diagnostics Cat #411381-C3 Fisher Tissue-Plus OCT Compound Clear Fisher Scientific Cat#23-730-571 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Osmium Tetroxide, 4% aqueous Electron Microscopy Sciences Cat#19190 Potassium Ferrocyanide, 10% aqueous Electron Microscopy Sciences Cat#25154-10 Thiocarbohydrazide Electron Microscopy Sciences Cat#21900 Uranyl Acetate Electron Microscopy Sciences Cat#22400 L-Aspartic Acid Alfa Aesar Cat#A13520 Sodium Cacodylate Trihydrate Electron Microscopy Sciences Cat#12310 Acetone Electron Microscopy Sciences Cat#10015 Durcapan ACM (Single Component A, M Epoxy) Sigma-Aldrich Cat#44611-500ML Durcapan ACM (Single Component B Hardener) Sigma-Aldrich Cat#44612-500ML Durcapan ACM (Single Component C Accelerator) Sigma-Aldrich Cat#44613-100ML Durcapan ACM (Component D) Electron Microscopy Sciences Cat#14042 Paraformaldehyde, 16% aqueous Electron Microscopy Sciences Cat#15710 Glutaraldehyde, 50% aqueous Electron Microscopy Sciences Cat#16320 Chicken Serum,USA origin, sterile-filtered, cell culture tested Sigma Cat#C5405-500ML DAPI Sigma Cat#D9542-10MG Aqua-Mount Fisher Scientific Cat#TA125am ProLong Gold Thermo Fisher Cat#P36934 Heparin Sodium Fisher Scientific Cat#H19 ACK Lysing Buffer Quality Biological Cat#118-156-101CS Low endotoxin heat shock BSA powder Equitech-Bio Cat#BAH70-1000 DNase I Sigma Cat#DN25-1G Collaganase VIII Sigma Cat#C2139 (Continued on next page) ll e4 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Zombie NIR Fixable Viability Kit BioLegend Cat#423106 Zombie Aqua Fixable Viability Kit BioLegend Cat#423102 LIVE/DEAD Fixable Blue Dead Cell Stain Kit Thermo Fisher Ca#L23105 Purified anti-Mouse CD16/CD32 (Fc block) BioLegend Cat#101302 Seurm-FBS Certified US origin Thermo Fisher Cat#16000044 eBioscience Cell Stimulation Cocktail eBioscience Cat#00-4970-03 Brefeldin A Solution eBioscience Cat#00-4506-51 Foxp3 / Transcription Factor Staining Buffer Set Kit eBioscience Cat#00-5523-00 LS columns Miltenyi Biotec Cat#130-042-401 MS columns Miltenyi Biotec Cat#130-042-201 Purified NA/LE Hamster Anti-Mouse CD28 BD Biosciences Cat#553294 Purified NA/LE Hamster Anti-Mouse CD3e BD Biosciences Cat#553057 Alt-R CRISPR-Cas9 Negative Control crRNA #1 IDT Cat#1072544 Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 TrueCut Cas9 Protein v2 Thermo Fisher Cat#A36499 Recombinant Murine IL-2 PeproTech Cat#212-12-500ug Corning HTS Transwell 96 well permeable supports Corning Cat#CLS3388 Recombinant Murine SDF-1a (CXCL12) PeproTech Cat#250-20A InVivoMAb rat IgG1 isotype control BioXCell Cat#BE0088 InVivoMAb rat IgG2b isotope control BioXCell Cat#BE0090 InVivoMAb anti-mouse/human VLA4 BioXCell Cat#BE0071 InVivo mAb anti-mouse LFA1a BioXCell Cat#BE0005-1 InVivoMAb anti-mouse PSGL-1 BioXCell Cat#BE0186-5MG Maxpar Fix and Perm Buffer Fluidigm Cat#201067 Maxpar Cell Staining Buffer Fluidigm Cat#201068 Cell-ID Cisplatin Fluidigm Cat#201064 Maxpar Nuclear Antigen Staining Buffer Set Fluidigm Cat#201063 Cell-ID Intercalator-Ir—125 mM Fluidigm Cat#201192A Invitrogen Ambion UltraPure BSA Thermo Fisher Cat#AM2616 Trypan blue, 0.4% Thermo Fisher Cat#15250061 Microcon-30kDa Centrifugal Filter Unit with Ultracel-30 membrane Millipore Cat#MRCF0R030 Critical commercial assays CD4+ T Cell Isolation Kit, mouse Miltenyi Biotec Cat#130-104-454 CD11c MiroBeads, UltraPure, mouse Miltenyi Biotec Cat#130-125-835 Cell-ID 20-Plex Pd Barcoding Kit Fluidigm Cat#201060 Chromium Single Cell 30 Library & Gel Bead Kit v2 10X Genomics Cat#PN-120267 Chromium Single Cell 30 Library & Gel Bead Kit v3 10X Genomics Cat#PN-120267 Amaxa P4 Primary Cell 4D-Nucleofector Kit Lonza Cat#V4XP-4024 Pierce Quantitative Fluorometric Peptide Assay Thermo Fisher Cat#23290 RNAscope Multiplex Fluorescent Reagent Kit V2 Advanced Cell Diagnostics Cat#323110 Tyramide Signal Amplification (TSA) Plus Fluorescence Palette Kit Perkin Elmer Cat#NEL760001KT (Continued on next page) ll Cell 184, 1000–1016.e1–e16, February 18, 2021 e5 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll

    other:

    Article Title: Functional characterization of the dural sinuses as a neuroimmune interface.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Fastq files and quantified gene counts for single cell sequencing Gene Expression Omnibus (GEO) GSE144175 Experimental models: organisms/strains C57BL/6 The Jackson Laboratory JAX000664 B6(FVB)-Cxcl12tm1.1Link/J The Jackson Laboratory JAX021773 B6(Cg)-Rag2tm1.1Cgn/J The Jackson Laboratory JAX008449 Cxcl12tm2.1Sjm/J The Jackson Laboratory JAX022458 B6.Cg-Tg(TcraTcrb)425Cbn/J The Jackson Laboratory JAX004194 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX000406 B6.Cg-Pdgfrbtm1.1(cre/ERT2)Csln/J The Jackson Laboratory JAX030201 C57BL/6-Tg(UBC-GFP)30Scha/J The Jackson Laboratory JAX004353 B6.Cg-Gt(ROSA)26Sortm9(CAGtdTomato)Hze/J The Jackson Laboratory JAX 007909 C57BL/6-Tg(Tcra2D2,Tcrb2D2)1Kuch/J The Jackson Laboratory JAX 006912 C57BL/6-Tg(Nr4a1-EGFP/cre)820Khog/J The Jackson Laboratory JAX 016617 B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax MMRRC/ The Jackson Laboratory MMRRC 34840-JAX Oligonucleotides 30- > 50 CXCR4-1 ttgactggcatagtcggcaa This paper IDT 30- > 50 CXCR4-2 ttgtcatcacactccccttc This paper IDT 30- > 50 CXCR4-3 tcgagagcatcgtgcacaag This paper IDT Software and algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FIJI package for ImageJ Schneider et al., 2012 https://imagej.net/Fiji FlowJo v10.3 Tree Star https://www.flowjo.com/ Trackmate Plugin for ImageJ v4.0.0 Tinevez et al., 2017 https://imagej.net/TrackMate MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Zunder Lab single-cell debarcoder Zunder et al., 2015 https://github.com/zunderlab/ single-cell-debarcoder Cytobank Beckman Coulter https://www.cytobank.org/ R Studio v3 R Studio https://rstudio.com/ Cytofkit Package for Bioconductor in R Chen et al., 2016 https://bioconductor.riken.jp/packages/3.7/ bioc/html/cytofkit.html Illumina Bcl2fastq software Illumina https://support.illumina.com/downloads/ bcl2fastq-conversion-software-v2-20.html Cellranger software pipeline v2.20 and v.4.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Seurat pipeline for R studio v.2.3.4 and 3.0 Butler et al., 2018 https://satijalab.org/seurat/install.html Prism v8 GraphPad https://www.graphpad.com/ scientific-software/prism/ Primer-Blast NCBI-NIH https://www.ncbi.nlm.nih.gov/tools/ primer-blast/ MaxQuant v1.6.17.0 Tyanova et al., 2016 https://www.maxquant.org/ The Human Protein Atlas (accessed 11/ 15/2020) Uhlén et al., 2015 https://www.proteinatlas.org/ humanproteome/brain/human+brain ll e6 Cell 184, 1000–1016.e1–e16, February 18, 2021 Article ll



    Similar Products

    foxp3 transcription factor staining buffer set kit ebioscience  (Miltenyi Biotec)
    97
    Miltenyi Biotec foxp3 transcription factor staining buffer set kit ebioscience
    Foxp3 Transcription Factor Staining Buffer Set Kit Ebioscience, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/Transcription+Factor+Staining+Buffer+Set/pm33508229-573-54-66
    Average 97 stars, based on 1 article reviews
    foxp3 transcription factor staining buffer set kit ebioscience - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    perm buffer from same kit ebioscience tm foxp3/transcription factor staining buffer set  (Thermo Fisher)
    90
    Thermo Fisher perm buffer from same kit ebioscience tm foxp3/transcription factor staining buffer set
    Perm Buffer From Same Kit Ebioscience Tm Foxp3/Transcription Factor Staining Buffer Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/foxp3+transcription+factor+staining+buffer+set/pmc10002750-157-22-27
    Average 90 stars, based on 1 article reviews
    perm buffer from same kit ebioscience tm foxp3/transcription factor staining buffer set - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    xyn zc 100 foxp3 transcription factor staining buffer set kit ebioscience  (Thermo Fisher)
    86
    Thermo Fisher xyn zc 100 foxp3 transcription factor staining buffer set kit ebioscience
    Xyn Zc 100 Foxp3 Transcription Factor Staining Buffer Set Kit Ebioscience, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/pm36351383-382-119-126
    Average 86 stars, based on 1 article reviews
    xyn zc 100 foxp3 transcription factor staining buffer set kit ebioscience - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    cell fixation and permeabilisation kit ebiosciences foxp3/transcription factor staining buffer set  (Thermo Fisher)
    90
    Thermo Fisher cell fixation and permeabilisation kit ebiosciences foxp3/transcription factor staining buffer set
    Cell Fixation And Permeabilisation Kit Ebiosciences Foxp3/Transcription Factor Staining Buffer Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/foxp3+transcription+factor+staining+buffer+set/pmc09727930-458-17-22
    Average 90 stars, based on 1 article reviews
    cell fixation and permeabilisation kit ebiosciences foxp3/transcription factor staining buffer set - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    commercial assay or kit ebioscience foxp3/transcription factor staining buffer set  (Thermo Fisher)
    90
    Thermo Fisher commercial assay or kit ebioscience foxp3/transcription factor staining buffer set
    Commercial Assay Or Kit Ebioscience Foxp3/Transcription Factor Staining Buffer Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/ebioscience+staining+buffer/10__7554_slash_elife__75492-319-180-194
    Average 90 stars, based on 1 article reviews
    commercial assay or kit ebioscience foxp3/transcription factor staining buffer set - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    intranuclear transcription factor staining kit ebioscience foxp3/transcription factor staining buffer set  (Thermo Fisher)
    90
    Thermo Fisher intranuclear transcription factor staining kit ebioscience foxp3/transcription factor staining buffer set
    Intranuclear Transcription Factor Staining Kit Ebioscience Foxp3/Transcription Factor Staining Buffer Set, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxp3+transcription+factor+staining+buffer+set+kit+ebioscience/foxp3+transcription+factor+staining+buffer+set/pmc08580318-262-17-16
    Average 90 stars, based on 1 article reviews
    intranuclear transcription factor staining kit ebioscience foxp3/transcription factor staining buffer set - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results